Tell me more ×
Database Administrators Stack Exchange is a question and answer site for database professionals who wish to improve their database skills and learn from others in the community. It's 100% free, no registration required.

I'm using PostgreSQL 8.4, but would like a standard SQL solution if possible. Consider the following table.

corrmodel=# SELECT * from data limit 1;
   id    | datasubgroup_id | datafile_id |           sequence           | index | seqindex | margstat | pvalue 
---------+-----------------+-------------+------------------------------+-------+----------+----------+--------
 1033473 |               3 |          10 | GGTGACCCCAAGCTCAGGGCTGACCTGC | 19042 |          |  70.7634 |      0

I want to return the query that has the following properties.

  1. All rows with the same datafile_id and index are grouped together.
  2. The groups are sorted first by average pvalue descending, then by average
    margstat, where the averages are across each group.

The two tables I am doing this query on have 2.2 million and 3.1 million rows, so I'd like something reasonably efficient. Each group consists of 5 rows. This solution by @Lamak works, but I had some trouble wrapping my head around it, and I think that a solution using window functions might be something I could actually understand. The following is close, but not correct, since the group is not preserved in this case.

SELECT datafile_id, 
       index, 
       pvalue, 
       margstat, 
       Avg(pvalue) 
         OVER ( 
           partition BY datafile_id, index) AS avg_pval, 
       Avg(margstat) 
         OVER ( 
           partition BY datafile_id, index) AS avg_margstat 
FROM   data 
ORDER  BY avg_pval DESC, 
          avg_margstat; 

Here is the first 10 rows of the query result for one of my data sets. I'd like something like this, but correct.

datafile_id | index | pvalue | margstat | avg_pval | avg_margstat 
-------------+-------+--------+----------+----------+--------------
          30 |   781 |      1 |  13.1568 |    0.998 |     12.52546
          30 |   781 |      1 |  12.3585 |    0.998 |     12.52546
          30 |   781 |      1 |  12.3495 |    0.998 |     12.52546
          30 |   781 |   0.99 |  11.9554 |    0.998 |     12.52546
          30 |   781 |      1 |  12.8071 |    0.998 |     12.52546
          23 |  1428 |   0.99 |  12.1711 |    0.998 |      12.6777
          23 |  1428 |      1 |  12.6451 |    0.998 |      12.6777
          23 |  1428 |      1 |  12.8814 |    0.998 |      12.6777
          23 |  1428 |      1 |  12.8969 |    0.998 |      12.6777
          23 |  1428 |      1 |   12.794 |    0.998 |      12.6777
share|improve this question
Why do you say that "grouping" is not preserved? It seems to be. You have all rows with same avg_pval and avg_margstat together. – ypercube Jan 11 at 19:19
Lamak's ORDER BY, translated into your query: ORDER BY avg_pval DESC, avg_margstat, datafile_id, index, pvalue DESC, margstat – ypercube Jan 11 at 19:31

1 Answer

As @ypercube pointed out in the comments, my query is quite close to the correct answer. The sort by avg_pval DESC, avg_margstat is actually close to the correct sort, only incorrect if the (avg_pval, margstat) tuple happens to have ties. So one can sort again, for a fixed (avg_pval, margstat), on datafile_id, index which will bring the groups back together. Finally, one can optionally sort within the groups, by pvalue DESC, margstat, Putting that all together, one gets

SELECT datafile_id, 
       index, 
       pvalue, 
       margstat, 
       Avg(pvalue) 
         OVER ( 
           partition BY datafile_id, index) AS avg_pval, 
       Avg(margstat) 
         OVER ( 
           partition BY datafile_id, index) AS avg_margstat 
FROM   data 
ORDER  BY avg_pval DESC, 
          avg_margstat, 
          datafile_id,
          index,
          pvalue DESC, 
          margstat;
share|improve this answer

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.